Nextera Xt Adapter Sequences

Nextera Xt Adapter Sequences



Illumina Adapter Sequences . Document # 1000000002694 v00 . 11. October 2015 . Nextera Index Kit – Index 2 (i5) Adapters . The i5 index names vary for different Nextera products as follows: N50x— Nextera DNA S50x— Nextera XT E50x— Nextera Enrichment and Nextera Rapid Capture . Nextera XT Index Kit v2 – Index 1 (i7) Adapters, 4/4/2019  · Illumina Nextera XT is one of our most used kits. The adapter sequence for this kit is: CTGTCTCTTATACACATCT The adapter sequences for other kits may be different, so be sure to check which kit was used for library prep and get the appropriate sequence from the adapter sequences manual. We deliver sequencing results in FASTQ and FASTA file formats..


6/1/2020  · Oligonucleotide (oligo) sequences of Illumina adapters used in AmpliSeq, Nextera , TruSeq, and TruSight library prep kits. Illumina Adapter Sequences Document Products Learn Company Support Recommended Links, Nextera XT DNA Library Prep Reference Guide Amplify Libraries This stepamplifies the tagmentedDNA using a limited-cyclePCR program.The PCR stepadds the Index 1 (i7) adapters ,Index 2 (i5) adapters ,and sequences requiredfor sequencing cluster generation.To confirm, Illumina Adapter Sequences Document. Oligonucleotide (oligo) sequences of Illumina adapters used in library prep kits. … Best Practices for Standard and Bead-Based Normalization in Nextera XT DNA Library Preparation Kits Technical Note Download: Technical Note < 1 MB: Mar 27, 2017: Searching for the Epigenetic Contributions of Addiction, Nextera XT DNA Library Prep Kit | Sequence small genomes ...Nextera XT DNA Sample Prep Kit Documentation - Illumina, Nextera XT DNA Sample Prep Kit Documentation - Illumina, Nextera XT DNA Library Prep Kit Reference Guide ... - Illumina, With Nextera technology, DNA is simultaneously fragmented and tagged with sequencing adapters in a single-tube enzymatic reaction. Nextera XT supports ultra-low DNA input of only 1 ng. It supports a wide range of input samples, including small genomes, PCR amplicons greater than 300 bp, plasmids, microbial genomes, concatenated amplicons, and double-stranded cDNA.If adapting the Nextera XT protocol for amplicons, use amplicons ? 300 bp in length. For full coverage of the entire amplicon region, make sure that primers have ? 50 bases upstream and downstream of your target of interest.Index1(i7) Adapters CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG Index2(i5) Adapters AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC PlateA/Set1IndexAdapters Index Name i7Basesin Adapter i7Basesfor SampleSheet i5BasesforSampleSheet NovaSeq6000withv1.0 reagentkits,MiSeq, HiSeq 2000/2500,NextSeq.Illumina Nextera XT tagmentation reaction mixtures were amplified using one custom IS-specific primer with a P5 adapter tail and a standard index-tagged P7 primer. The schematic was adapted from figures originally designed by Illumina and by Pekka Ellonen and used with permission.Plexity Index1(i7) Adapters Index2(i5) Adapters 2–6 Atleasttwouniquei7adapters Atleasttwouniquei5adapters 7–12 Oneofthefollowingcombinations: •N701,N702,N704,andanyotheri7adapter •N703,N705,N706,andanyotheri7adapter Oneofthefollowingcombinations: •N503andN504 •N505andN506 >12 …

Advertiser